View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_low_24 (Length: 344)
Name: NF5676_low_24
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 328
Target Start/End: Complemental strand, 14972864 - 14972565
Alignment:
| Q |
13 |
aatatggtgagtggtccgaatagggtcgggcccctatcttgataaatttgaatgaacttgacctcaacaccgagacaactccatctactaacagcccagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14972864 |
aatatggtgagtggtccgaatagggtcgggcccctatcttgataaattcgaatgaacttgacctcaacaccgagacaac----------------ccagt |
14972781 |
T |
 |
| Q |
113 |
acaataacccgacaactttaaacatcaacaaccatttatggccaacaaatttaaggctattaggaagcaaccaaaagttatgcttagacaaccctcaacc |
212 |
Q |
| |
|
||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14972780 |
acatcaacccgacaactttaagcatcatcaaccatttatggccaacaaatttaaggctattaggaagaaaccaaaagttatgcttagacaaccctcaacc |
14972681 |
T |
 |
| Q |
213 |
caaaagttggttttcggatctcttgggacgaagcaataaaactagaaacgaaccactatagaaagaggcggaggttcaacatgatcaactagaaccaaga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14972680 |
caaaagttggttttcggatctcttgggacgaagcaataaaactagaaaccaaccactatagaaagaggcggaggttcaacatgatcaactagaaccaaga |
14972581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University