View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_low_43 (Length: 244)
Name: NF5676_low_43
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 14 - 168
Target Start/End: Original strand, 37011723 - 37011877
Alignment:
| Q |
14 |
atcagaaacataacaagctagcttgtttgctggataatcaagtgccaacaatgataacactgtattcactgtgcttattggtggttctagcactggatct |
113 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37011723 |
atcagaaacataacaagctagcttattagcaggataatcaagtgccaacaatgataacactgtattcactgtgattattggtggttctagcactggatct |
37011822 |
T |
|
| Q |
114 |
gctgttgttacaaacatgtccaatgctggaagctcagaatcagatacccttttgg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37011823 |
gctgttgttacaaacatgtccaatgctggaagctcagaatcagatacccttttgg |
37011877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 14 - 142
Target Start/End: Original strand, 37027813 - 37027941
Alignment:
| Q |
14 |
atcagaaacataacaagctagcttgtttgctggataatcaagtgccaacaatgataacactgtattcactgtgcttattggtggttctagcactggatct |
113 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
37027813 |
atcagaaacatagcatgctagcttgtttgctggataatcaagtgccaacaatgacaacactgtattcactgtgattattggtggttctagccctggatct |
37027912 |
T |
|
| Q |
114 |
gctgttgttacaaacatgtccaatgctgg |
142 |
Q |
| |
|
|| ||||| ||||||| |||||||||||| |
|
|
| T |
37027913 |
gccgttgtcacaaacaagtccaatgctgg |
37027941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 14 - 129
Target Start/End: Original strand, 37045753 - 37045868
Alignment:
| Q |
14 |
atcagaaacataacaagctagcttgtttgctggataatcaagtgccaacaatgataacactgtattcactgtgcttattggtggttctagcactggatct |
113 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| | || || || || |||| |||| | ||||||||||| || || |||||| |
|
|
| T |
37045753 |
atcagaaacataacaagctagcttattagctggataatcaagtgccaatagagacaaaacagtgttcaatgtgatgattggtggttcaagtacaggatct |
37045852 |
T |
|
| Q |
114 |
gctgttgttacaaaca |
129 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
37045853 |
gctgttgtcacaaaca |
37045868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 14 - 129
Target Start/End: Original strand, 37036413 - 37036528
Alignment:
| Q |
14 |
atcagaaacataacaagctagcttgtttgctggataatcaagtgccaacaatgataacactgtattcactgtgcttattggtggttctagcactggatct |
113 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||| ||||| | || || || || |||| |||| | ||||||||||| || || |||||| |
|
|
| T |
37036413 |
atcagaaacataacaagctagcttattagctggataatcaagagccaatagagacaaaacagtgttcaatgtgatgattggtggttcaagtacaggatct |
37036512 |
T |
|
| Q |
114 |
gctgttgttacaaaca |
129 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
37036513 |
gctgttgtcacaaaca |
37036528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University