View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_low_44 (Length: 241)
Name: NF5676_low_44
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_low_44 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 21358501 - 21358281
Alignment:
| Q |
19 |
gtggcggacaagatggttccccaatgttggagggtactactagtggagagccttctatgaaaggactaaactcgaagaaaaggaaaagaagtggacaggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21358501 |
gtggcggacaagatggttccccaatgttggagggtactactagtggagagccttctatgaaaggactaaactcgaagaaaaggaaaagaagtggacaggt |
21358402 |
T |
 |
| Q |
119 |
atggtttgttacttttttgagctttattttgttgtgcgtgattactattttgccttatgtgataaagtttttccttgtggtaggatgctgataatgataa |
218 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21358401 |
acggtttgttac--ttttgagctttattttgttgtgcgtgattactattttgccttatgtgatagagtttttccttgtggtaggatgctgataatgataa |
21358304 |
T |
 |
| Q |
219 |
acccaatggaactcaagaactac |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
21358303 |
acccaatggaactcaagaactac |
21358281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 120
Target Start/End: Original strand, 27328836 - 27328896
Alignment:
| Q |
60 |
agtggagagccttctatgaaaggactaaactcgaagaaaaggaaaagaagtggacaggtat |
120 |
Q |
| |
|
|||||||| |||||||| ||||| ||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
27328836 |
agtggagaaccttctattaaaggtctaaatccaaagaaaaggaaaagaaatggacaggtat |
27328896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University