View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_low_49 (Length: 236)
Name: NF5676_low_49
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 74 - 204
Target Start/End: Original strand, 17356121 - 17356249
Alignment:
| Q |
74 |
ttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagcatataattgttttg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
17356121 |
ttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagc--ataattgttttg |
17356218 |
T |
 |
| Q |
174 |
gatttttcatgaaaaattattctaaattcat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17356219 |
gatttttcatgaaaaattattctaaattcat |
17356249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 159
Target Start/End: Complemental strand, 36620022 - 36619953
Alignment:
| Q |
90 |
tgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagc |
159 |
Q |
| |
|
|||| |||||| ||||||| |||| | | |||||||||||||||||| ||||||||| || | ||||||| |
|
|
| T |
36620022 |
tgtgtttcatgtgaacttcaattttgcgttttgttgttttccttcactttattgtttctacagaagcagc |
36619953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University