View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5676_low_49 (Length: 236)

Name: NF5676_low_49
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5676_low_49
NF5676_low_49
[»] chr7 (1 HSPs)
chr7 (74-204)||(17356121-17356249)
[»] chr8 (1 HSPs)
chr8 (90-159)||(36619953-36620022)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 74 - 204
Target Start/End: Original strand, 17356121 - 17356249
Alignment:
74 ttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagcatataattgttttg 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||||||||  ||||||||||||    
17356121 ttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagc--ataattgttttg 17356218  T
174 gatttttcatgaaaaattattctaaattcat 204  Q
    |||||||||||||||||||||||||||||||    
17356219 gatttttcatgaaaaattattctaaattcat 17356249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 159
Target Start/End: Complemental strand, 36620022 - 36619953
Alignment:
90 tgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagc 159  Q
    |||| |||||| ||||||| |||| | | |||||||||||||||||| ||||||||| || | |||||||    
36620022 tgtgtttcatgtgaacttcaattttgcgttttgttgttttccttcactttattgtttctacagaagcagc 36619953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University