View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5676_low_52 (Length: 228)

Name: NF5676_low_52
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5676_low_52
NF5676_low_52
[»] chr7 (1 HSPs)
chr7 (13-171)||(2841105-2841263)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 13 - 171
Target Start/End: Original strand, 2841105 - 2841263
Alignment:
13 taatggagctacgaacagtcaccacagagtgtgtccctgcaatttagaaacctgtggcatttggtgattgaaggctattgtgctggagttatatgatata 112  Q
    |||||||||||||||||||||| ||||||||| | ||||||||| |||||||||| |||| ||||||||||||| ||||||| ||||||||| |||||||    
2841105 taatggagctacgaacagtcactacagagtgtatacctgcaattcagaaacctgttgcatatggtgattgaaggttattgtgttggagttatctgatata 2841204  T
113 gtgcaagtgcatgtatcacatattacggtggtttgtcaaatccacaaatttcaacaaaa 171  Q
    |||| |||||||||||||||||||||||||||||||||||  ||||||||| |||||||    
2841205 gtgctagtgcatgtatcacatattacggtggtttgtcaaaaacacaaatttaaacaaaa 2841263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University