View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5676_low_52 (Length: 228)
Name: NF5676_low_52
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5676_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 13 - 171
Target Start/End: Original strand, 2841105 - 2841263
Alignment:
| Q |
13 |
taatggagctacgaacagtcaccacagagtgtgtccctgcaatttagaaacctgtggcatttggtgattgaaggctattgtgctggagttatatgatata |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||||| |||||||||| |||| ||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
2841105 |
taatggagctacgaacagtcactacagagtgtatacctgcaattcagaaacctgttgcatatggtgattgaaggttattgtgttggagttatctgatata |
2841204 |
T |
 |
| Q |
113 |
gtgcaagtgcatgtatcacatattacggtggtttgtcaaatccacaaatttcaacaaaa |
171 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2841205 |
gtgctagtgcatgtatcacatattacggtggtttgtcaaaaacacaaatttaaacaaaa |
2841263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University