View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5678_high_8 (Length: 241)
Name: NF5678_high_8
Description: NF5678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5678_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 47 - 158
Target Start/End: Complemental strand, 24541562 - 24541451
Alignment:
| Q |
47 |
caaagttttatatattactaaagagtaataggagtattcaaattctgtttggcaaagtgcgcaaatnnnnnnnttatgaagccttgaattaacaaccaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
24541562 |
caaagttttatatattactaaagagtaataggagtattcaaattctgtttggcaaagtgcgcaaataaaaaaattctgaagccttgaattaacaaccaaa |
24541463 |
T |
 |
| Q |
147 |
ttacaccaacaa |
158 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24541462 |
ttacaccaacaa |
24541451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 175 - 224
Target Start/End: Complemental strand, 24541424 - 24541376
Alignment:
| Q |
175 |
ctaaacttttaccgacagaaaattcgtgagaataaaaatcatatgatcac |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24541424 |
ctaaacttttaccgacagaaaattcgt-agaataaaaatcatatgatcac |
24541376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University