View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5678_low_5 (Length: 344)
Name: NF5678_low_5
Description: NF5678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5678_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 124 - 321
Target Start/End: Complemental strand, 50336623 - 50336423
Alignment:
| Q |
124 |
gtgaagagaagagggaagattctttggtatctatttttgtgttctatgggaagaaaaaagaaggaagcaacaaacatgagagtgagatgagtattattat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336623 |
gtgaagagaagagggaagattctttggtatctatttttgtgttctatgggaagaaaaaagaaggaagcaacaaacatgagagtgagatgagtattattat |
50336524 |
T |
 |
| Q |
224 |
t---ggtaagaagaatcaaacgaacgagcactgctcaccacacaaaagtacacattttggccaatggttttccgtcacgcaaaaatcttcctaacatcga |
320 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50336523 |
tattggtaagaagaatcaaacgaacgagcactgctcaccacacaaaagtacacattttggccaatggttttccgtcacgcaaaaatcttcctaccatcga |
50336424 |
T |
 |
| Q |
321 |
c |
321 |
Q |
| |
|
| |
|
|
| T |
50336423 |
c |
50336423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University