View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5679-Insertion-1 (Length: 212)
Name: NF5679-Insertion-1
Description: NF5679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5679-Insertion-1 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 31009163 - 31009367
Alignment:
| Q |
8 |
aagcacacaacacaaaaatggggtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009163 |
aagcacacaacacaaaaatggggtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaaac |
31009262 |
T |
 |
| Q |
108 |
ctttgcaaacctcttcattgcaattgtaggtgcaggtgttcctggtctcccttatactttcacgaaaacaggttggattatggggttgcttatgcttttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31009263 |
ctttgcaaacctcttcattgcaattgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggatcatggggttgcttatgcttttc |
31009362 |
T |
 |
| Q |
208 |
tctgt |
212 |
Q |
| |
|
||||| |
|
|
| T |
31009363 |
tctgt |
31009367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University