View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5680-Insertion-9 (Length: 100)
Name: NF5680-Insertion-9
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5680-Insertion-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 942059 - 942151
Alignment:
| Q |
8 |
aggtttagatgcggaggatgatttgagtgaacggacggtgttggcttggatttcaacggcggagagtttctccgctagggttttgcgtagggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
942059 |
aggtttagatgcggaggatgatttgagtgaacggacggtgttggcttggatttcaacggcggagagtttctccgctagggttttgcgtagggt |
942151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.000000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.000000000008
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 49825935 - 49825978
Alignment:
| Q |
8 |
aggtttagatgcggaggatgatttgagtgaacggacggtgttgg |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
49825935 |
aggtttagatgcggaggatgattttagtgagcggacggtgttgg |
49825978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 836545 - 836613
Alignment:
| Q |
8 |
aggtttagatgcggaggatgatttgagtgaacggacggtgttggcttggatttcaacggcggagagttt |
76 |
Q |
| |
|
|||||||| || ||||| ||||| ||||||||||| |||||| ||||||||| || ||||||||||| |
|
|
| T |
836545 |
aggtttaggagctgaggaagattttagtgaacggactgtgttgctttggatttcgactgcggagagttt |
836613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University