View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5680_high_23 (Length: 246)
Name: NF5680_high_23
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5680_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 18101143 - 18100929
Alignment:
| Q |
16 |
atcccaaatatgcaaactagacctctccaacgaactttttggcggcgtcaacgatgcatgtggaaacaacctcgatcgaagccgctgttgtcccgtactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18101143 |
atcccaaatatgcaaactagacctctccaacgaactctttggcggcgtcaacgatgcatgtggaaacaacctcgatcgaagccgctgttgtcccgtactc |
18101044 |
T |
 |
| Q |
116 |
acggcctggctcttcgcggctcatgcgcgaagagcattagagatttctcctccaccaccggaaaattcagtcgatcttccgatgatgccggatgattctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18101043 |
gcggcctggctcttcgcggctcatgcgcgaagagcattagagatttctcctccaccacgggaaaattcagtcgatcttccgatgatgccggatgattctc |
18100944 |
T |
 |
| Q |
216 |
agaagtgtgttaact |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
18100943 |
agaagtgtgttaact |
18100929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 37858751 - 37858537
Alignment:
| Q |
16 |
atcccaaatatgcaaactagacctctccaacgaactttttggcggcgtcaacgatgcatgtggaaacaacctcgatcgaagccgctgttgtcccgtactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37858751 |
atcccaaatatgcaaactagacctctccaacgaactctttggcggcgtcaacgatgcatgtggaaacaacctcgatcgaagccgctgttgtcccgtactc |
37858652 |
T |
 |
| Q |
116 |
acggcctggctcttcgcggctcatgcgcgaagagcattagagatttctcctccaccaccggaaaattcagtcgatcttccgatgatgccggatgattctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37858651 |
gcggcctggctcttcgcggctcatgcgcgaagagcattagagatttctcctccaccacgggaaaattcagtcgatcttccgatgatgccggatgattctc |
37858552 |
T |
 |
| Q |
216 |
agaagtgtgttaact |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37858551 |
agaagtgtgttaact |
37858537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University