View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5680_high_24 (Length: 246)

Name: NF5680_high_24
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5680_high_24
NF5680_high_24
[»] chr3 (2 HSPs)
chr3 (1-96)||(9667770-9667864)
chr3 (159-237)||(9667927-9668006)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 9667770 - 9667864
Alignment:
1 ttctgtgtctggaatatggatttagaattgaatgggcttaaagaactagaagatggactttgagaaatggcttatgtttttccaaagctaaggggg 96  Q
    ||||||||||||||||||||||  ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
9667770 ttctgtgtctggaatatggattg-gaattgaatgggcttaaagaactggaagatggactatgagaaatggcttatgtttttccaaagctaaggggg 9667864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 9667927 - 9668006
Alignment:
159 gtgttattctctcttattctttatattgt-aatagtccttgcggtcttttaccatctaagttgtacttatgaaacaaatt 237  Q
    ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||| |||||||||||||    
9667927 gtgttattctctcttattctttatattgttaatagtccttacggtcttttaccatctaaattgtacgtatgaaacaaatt 9668006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University