View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5680_low_19 (Length: 276)
Name: NF5680_low_19
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5680_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 258
Target Start/End: Original strand, 3685664 - 3685917
Alignment:
| Q |
5 |
agaaaccaggcaagcaaaagataaccctgcatgcataggtttttcgaaagcaattaagacaccatttgctcgaaatgttcacctccagtcaatgaacata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685664 |
agaaaccaggcaagcaaaagataaccctgcatgcataggtttttcgaaagcaattaagacaccatttgctcgaaatgttcacctccagtcaatgaacata |
3685763 |
T |
|
| Q |
105 |
tagttgtgcaatctgaattaacagtaacaggtgatgctcagccacgtactgatgaagcataactagcaatataagatgagcaaccaagcatgaaaggttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685764 |
tagttgtgcaatctgaattaacagtaacaggtgattttcaaccacgtactgatgaagcacgactagcaatataagatgagcaaccaagcatgaaaggttg |
3685863 |
T |
|
| Q |
205 |
tgtaacaagtgatagatgagacacatatagtttctcatgctgcaccactgcccc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685864 |
cgtaacaagtgatagatgagacacatatagtttctcatgctgcaccactgcccc |
3685917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University