View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5680_low_25 (Length: 246)
Name: NF5680_low_25
Description: NF5680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5680_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 9667770 - 9667864
Alignment:
| Q |
1 |
ttctgtgtctggaatatggatttagaattgaatgggcttaaagaactagaagatggactttgagaaatggcttatgtttttccaaagctaaggggg |
96 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9667770 |
ttctgtgtctggaatatggattg-gaattgaatgggcttaaagaactggaagatggactatgagaaatggcttatgtttttccaaagctaaggggg |
9667864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 9667927 - 9668006
Alignment:
| Q |
159 |
gtgttattctctcttattctttatattgt-aatagtccttgcggtcttttaccatctaagttgtacttatgaaacaaatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
9667927 |
gtgttattctctcttattctttatattgttaatagtccttacggtcttttaccatctaaattgtacgtatgaaacaaatt |
9668006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University