View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5681_high_14 (Length: 291)
Name: NF5681_high_14
Description: NF5681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5681_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 83 - 273
Target Start/End: Original strand, 16790617 - 16790807
Alignment:
| Q |
83 |
gtcacaccccaaggttattctgattatttgaggaactgttgccataaattttttcatccgggtctcaattcgatttagtcttatattttccgtgaaagaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16790617 |
gtcacaccccaaggttattctgattatttgaggaactgttgccataaattttttcatccgggtctcaattcgatttgctcttatattttccgtgaaagaa |
16790716 |
T |
|
| Q |
183 |
attattgtgcggataaattagcagatcacagtcatactattgctggcaccatttggttcaacactattcctcagtttttgttggaggactt |
273 |
Q |
| |
|
||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16790717 |
attgttgtgcggataaattagcaaatcatagtcatactattgctggcaccatttggttcaacactattcctcattttttgttggaggactt |
16790807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 16790547 - 16790586
Alignment:
| Q |
13 |
aatatcatgtggaagaacacttgaaatccccaaccatttt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16790547 |
aatatcatgtggaagaacacttgaaatccccaaccatttt |
16790586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University