View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5681_low_15 (Length: 278)
Name: NF5681_low_15
Description: NF5681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5681_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 162
Target Start/End: Original strand, 46794972 - 46795116
Alignment:
| Q |
18 |
agtttcagtactatcagcaggtgatgttgaagatgacatcaattgttgcagcatttgttgagtatttgttgaatctgcaccaggcccagggtacctaatt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46794972 |
agtttcagtactatcaacaggtgatgttgaagatgaaatcaattgttgcagcatttgttgagtatttgttgaatctgcaccaggcccagggtacctaatt |
46795071 |
T |
 |
| Q |
118 |
tcttcttgttgcattcttccactgctacacatcttgtaacaagtc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795072 |
tcttcttgttgcattcttccactgctacacatcttgtaacaagtc |
46795116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 221 - 257
Target Start/End: Original strand, 46795175 - 46795211
Alignment:
| Q |
221 |
gtgtccatttcaattttctccctttagaagaacaact |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795175 |
gtgtccatttcaattttctccctttagaagaacaact |
46795211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University