View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_high_10 (Length: 343)
Name: NF5682_high_10
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 333
Target Start/End: Original strand, 1677082 - 1677398
Alignment:
| Q |
19 |
ataggatctcaatatataaataatacttattttgtgcaattgcagtcaggtatagatcaggatggggtgcattggcatggtgtgttgctttattattatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1677082 |
ataggatctcaatatataaataatacttattttgtgcaattgcagtcaggtatagatcaggatggggtgcattggcatggtgtgttgctttattattatt |
1677181 |
T |
 |
| Q |
119 |
gcagccaatattcgaaaccaaattatttgtaatacttctcatcatttttcttctaaatgcctctctcagtttcctcttcattcctaataaacacttgaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1677182 |
gcagccaatattcgaaaccaaattatttgtaatacttctcatcatttttcttctaaatgcctctctcagtttcctcttcattcctaataaacacttgaga |
1677281 |
T |
 |
| Q |
219 |
tgaaccagttgcagagatac-ttatttgctgcaccacttatatttcaaaagacaaaattatgcccgtggtaccttaa-nnnnnnnnnaatagcaaagaga |
316 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1677282 |
tgaaccagttgcagagatacattatttgctgcaccacttatatttcaaaagacaaaattatgcccgtggtaccttaattttttttttaatagcaaagaga |
1677381 |
T |
 |
| Q |
317 |
acttttattaagtataa |
333 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
1677382 |
acttttaataagtataa |
1677398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University