View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_high_19 (Length: 246)
Name: NF5682_high_19
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 45973685 - 45973905
Alignment:
| Q |
1 |
aattaaccttcaggatcgtagtgtctccggctgggttgcagacttgataagtcgctgtctttatcaaagcttgatgaatcaacccatttatgtttaaaga |
100 |
Q |
| |
|
||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45973685 |
aattaaccttctggatcgtattgtctccgtctgggttgcagacttgataagtcgctgtctttatcaaagcttgatgaatcaacccatttatgttt-aaga |
45973783 |
T |
|
| Q |
101 |
cattcatcgtgttaaagatggtgagaaacacaaggagaaag---ggaggagtttgagattccaaatttttacagaagaacgtgtttgagcaggcaaatat |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45973784 |
cattcatcgtgttgaagatggtgagaaacacaaggagaaagggaggaggagtttgggattccaaatttttacagaagaacgtgttt---------aatat |
45973874 |
T |
|
| Q |
198 |
tctgtgtagtgggtttaacgtggaataaatt |
228 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
45973875 |
tctgtgcagtgggtttaacgtggaataaatt |
45973905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 97
Target Start/End: Original strand, 9496906 - 9496993
Alignment:
| Q |
13 |
ggatcgtagtgtctccggctgggttgcagacttgataagtcgct-gtctttatcaaagcttgatgaatcaacc--catttatgtttaa |
97 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||| ||| ||| ||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9496906 |
ggatcgtattgtctccgtcttggttgcagacttgatgagttgctaatctttttcaaagcttgatgaatcaacccgcatttatgtttaa |
9496993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University