View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_high_21 (Length: 219)
Name: NF5682_high_21
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 7 - 69
Target Start/End: Original strand, 3928931 - 3928993
Alignment:
| Q |
7 |
atatagtattgaaatagtgcaagttttagttttgaaagtgattgacttgaaatatggtttagt |
69 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
3928931 |
atatattattgaaatagtgcaagttttagttttgaaagtgattgacttgaaatctggtatagt |
3928993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 72 - 134
Target Start/End: Original strand, 3929147 - 3929209
Alignment:
| Q |
72 |
tggaaggatggaacggcattaatcaacaggcgttaacagaaggatggaagtaacatttgacag |
134 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
3929147 |
tggaaggatggaatgacattaatcaacaggcgttaactgaaggatggaagtaaaatttgacag |
3929209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 73 - 136
Target Start/End: Original strand, 3914775 - 3914842
Alignment:
| Q |
73 |
ggaaggatggaacggcattaatcaacaggcgttaacagaaggatgga----agtaacatttgacagaa |
136 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
3914775 |
ggaaggatggaacgacattaatcgacagacgttaacagaaagatggaattgagtaacatttgacagaa |
3914842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University