View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_high_8 (Length: 382)
Name: NF5682_high_8
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 64 - 328
Target Start/End: Complemental strand, 48880182 - 48879918
Alignment:
| Q |
64 |
taccttaagaatgtattggtttagctaactatgtgatttctggtgttttagaaaaatgctcgggtagtctctattgatggatatgaagatgttcctcaga |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48880182 |
taccttaagaatgtattggtttagctaactatgtgatttctggtgttttagaaaaatgctcgggtagtctctattgatggatatgaagatgttcctcaga |
48880083 |
T |
 |
| Q |
164 |
atgatgagaaatctttgaagaaggcggttgcacatcaacctgttagcgttgccattgaagctggtggcagggcatttcaactttaccaatcggtattata |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48880082 |
atgatgagaaatctttgaagaaggcggttgcacatcaacctgttagcgttgccattgaagctggtggcagggcatttcaactttaccaatcggtattata |
48879983 |
T |
 |
| Q |
264 |
tctatctctttcttaattacttttttatgatgacaattgtgtaacattaagtgattaattgttca |
328 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879982 |
tttatctctttcttaattacttttttatgatgacaattgtgtaacattaagtgattaattgttca |
48879918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University