View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_high_9 (Length: 358)
Name: NF5682_high_9
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 2484497 - 2484151
Alignment:
| Q |
1 |
tcaaaatactttgaaggttatttggttgccttgaaaatttgt----ttattcaaattcgtaatgcatccacgtcttgaatgttgcggaatgggaagactt |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||| |||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
2484497 |
tcaaaatactttgaaggttatttggctgccttgaaagtttgtctgtttattcaaattcgaaatgcatccatgtcttgaatgttgtggaatgggaagactt |
2484398 |
T |
|
| Q |
97 |
tggaggaattcatcatgctcatggcattctgcaaggatatcacatcacatattttcttatatttttgtctctttttcacttgtttaacctagctgttgac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484397 |
tggaggaattcatcatgctcatggcattctgcaaggatatcacatcacatattttcttatatttttgtctctttttcacttgtttaacctagctgttgac |
2484298 |
T |
|
| Q |
197 |
caatatatattaggtcatggttgcttgcacatggagtccctaagatctctcactttgtctttgtagatgatattatgttgcttttggttatgatatataa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484297 |
caatatatattaggtcatggttgcttgcacatggagtccctaagatctctcactttgtctttgtagatgatattatgttgcttttggttatgatatataa |
2484198 |
T |
|
| Q |
297 |
cacttcatggaattgcttcactttttgaaattcatcatggtttgatc |
343 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484197 |
cacttcatgcaattgcttcactttttgaaattcatcatggtttgatc |
2484151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 271 - 343
Target Start/End: Original strand, 30455183 - 30455253
Alignment:
| Q |
271 |
atgttgcttttggttatgatatataacacttcatggaattgcttcactttttgaaattcatcatggtttgatc |
343 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30455183 |
atgttgctattggttatgatata--acacctcatggaattgcttcactttttgaaattcattatggtttgatc |
30455253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 302 - 339
Target Start/End: Original strand, 36053392 - 36053429
Alignment:
| Q |
302 |
catggaattgcttcactttttgaaattcatcatggttt |
339 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
36053392 |
catggaattgcttcactttttaaaactcatcatggttt |
36053429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University