View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_low_15 (Length: 304)
Name: NF5682_low_15
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 188
Target Start/End: Complemental strand, 38685334 - 38685296
Alignment:
| Q |
150 |
tggaagtaattgaatataaccacatgtgtcagtgtcatg |
188 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38685334 |
tggaagtaattgaatgtaaccacatgtgtcagtgtcatg |
38685296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 150 - 183
Target Start/End: Complemental strand, 10948799 - 10948766
Alignment:
| Q |
150 |
tggaagtaattgaatataaccacatgtgtcagtg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
10948799 |
tggaagtaattgaatataaccacatgtgttagtg |
10948766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 18814845 - 18814805
Alignment:
| Q |
155 |
gtaattgaatataaccacatgtgtcagtgtcatgttggtgt |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
18814845 |
gtaattgaatataaccacatgtgttagtgtcgtgttggtgt |
18814805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 193
Target Start/End: Complemental strand, 24105320 - 24105283
Alignment:
| Q |
156 |
taattgaatataaccacatgtgtcagtgtcatgttggt |
193 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
24105320 |
taattgaatataatcaaatgtgtcagtgtcatgttggt |
24105283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 152 - 189
Target Start/End: Complemental strand, 2304092 - 2304055
Alignment:
| Q |
152 |
gaagtaattgaatataaccacatgtgtcagtgtcatgt |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
2304092 |
gaagtaattgaacataaccacatgtgtcagtatcatgt |
2304055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University