View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_low_17 (Length: 293)
Name: NF5682_low_17
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 54 - 173
Target Start/End: Complemental strand, 10279283 - 10279164
Alignment:
| Q |
54 |
taattgataaattttatttgtatatgtctatgtgtgtattaattttgtaagcattaacaatcatgttctacttattgattatcactagtaaaaatattaa |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10279283 |
taattgataaattttatttgtatatgtctatgtgtgtattaactttgttagcattaacaatcatgttctacttattgattatcactagtaaaaatattaa |
10279184 |
T |
 |
| Q |
154 |
agttacttcagaacaatgtg |
173 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
10279183 |
agttacttcagaaaaatgtg |
10279164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University