View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5682_low_17 (Length: 293)

Name: NF5682_low_17
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5682_low_17
NF5682_low_17
[»] chr6 (1 HSPs)
chr6 (54-173)||(10279164-10279283)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 54 - 173
Target Start/End: Complemental strand, 10279283 - 10279164
Alignment:
54 taattgataaattttatttgtatatgtctatgtgtgtattaattttgtaagcattaacaatcatgttctacttattgattatcactagtaaaaatattaa 153  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
10279283 taattgataaattttatttgtatatgtctatgtgtgtattaactttgttagcattaacaatcatgttctacttattgattatcactagtaaaaatattaa 10279184  T
154 agttacttcagaacaatgtg 173  Q
    ||||||||||||| ||||||    
10279183 agttacttcagaaaaatgtg 10279164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University