View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5682_low_21 (Length: 260)
Name: NF5682_low_21
Description: NF5682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5682_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 118 - 244
Target Start/End: Complemental strand, 7546418 - 7546292
Alignment:
| Q |
118 |
tatttacacttacattttcagtgcataccatttaaatctgctactgtatgtgtaaacccttgcatagagtatgaactatttcatttctcaaatcatcgaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7546418 |
tatttacacttacattttcagtgcataccatttaaatctgctactatatgtgtaaacccttgcatagagtatgaactatttcatttctcaaatcatcgaa |
7546319 |
T |
|
| Q |
218 |
agcataggcttttggagggcatcgttg |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7546318 |
agcataggcttttggagggcatcgttg |
7546292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University