View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5683-Insertion-7 (Length: 196)
Name: NF5683-Insertion-7
Description: NF5683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5683-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 62 - 154
Target Start/End: Complemental strand, 5468432 - 5468339
Alignment:
| Q |
62 |
ggcatggtgtttcgtgtgtatcacacacacttacacccacataaa-aaaagaacaaatattaataatttaacaatctacattcactttcttttg |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5468432 |
ggcatggtgtttcgtgtgtatcacacacacttacacccacataaaaaaaagaacaaatattaataatttaacaatctaaattcactttcttttg |
5468339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 5468491 - 5468450
Alignment:
| Q |
7 |
aatatcctcgtataccctttccttaatcaacttcatacacaa |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5468491 |
aatatcctcgtataccctttccttaatcaacttcatatacaa |
5468450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University