View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5683_low_15 (Length: 235)
Name: NF5683_low_15
Description: NF5683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5683_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 14112164 - 14111930
Alignment:
| Q |
1 |
atcacactgagatattaacagaatcaccgaaaggaacacacatatgtcttgaatattatgcttggatcggaggtgaattcgaaagaatcactgtgaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| | |
|
|
| T |
14112164 |
atcacactgagatattaacagaatcaccgaaaggaacacacatatgtcttgaatattatgcttggatcggaggtgaattcaaaagaatcacattgaatta |
14112065 |
T |
 |
| Q |
101 |
ttgtcgttttggcaaaaactacacttttgaatttcaacaaaattatgttaccaccatgattttgctaaacttacaattcatctaaacattagtgtaaaac |
200 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
14112064 |
ttgtcattttggcaaaaactgcacttttgaatttcaacaaaattatgttaccaccatgattttgctaaacttacaactcatttaaacattagtgtaaaac |
14111965 |
T |
 |
| Q |
201 |
aatgtagcactaatatgaacaccaaacacaacact |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14111964 |
aatgtagcactaatatgaacaccaaacacaacact |
14111930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University