View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5683_low_15 (Length: 235)

Name: NF5683_low_15
Description: NF5683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5683_low_15
NF5683_low_15
[»] chr4 (1 HSPs)
chr4 (1-235)||(14111930-14112164)


Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 14112164 - 14111930
Alignment:
1 atcacactgagatattaacagaatcaccgaaaggaacacacatatgtcttgaatattatgcttggatcggaggtgaattcgaaagaatcactgtgaatca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||| |    
14112164 atcacactgagatattaacagaatcaccgaaaggaacacacatatgtcttgaatattatgcttggatcggaggtgaattcaaaagaatcacattgaatta 14112065  T
101 ttgtcgttttggcaaaaactacacttttgaatttcaacaaaattatgttaccaccatgattttgctaaacttacaattcatctaaacattagtgtaaaac 200  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||    
14112064 ttgtcattttggcaaaaactgcacttttgaatttcaacaaaattatgttaccaccatgattttgctaaacttacaactcatttaaacattagtgtaaaac 14111965  T
201 aatgtagcactaatatgaacaccaaacacaacact 235  Q
    |||||||||||||||||||||||||||||||||||    
14111964 aatgtagcactaatatgaacaccaaacacaacact 14111930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University