View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_high_20 (Length: 324)
Name: NF5684_high_20
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 37 - 306
Target Start/End: Complemental strand, 42968746 - 42968478
Alignment:
| Q |
37 |
ggtgtaggtgaagcgtcttaccaactaagttgagcttcattgtcaatttttaatattaattaagaaaataaacttattaggctgaatatttattggccaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968746 |
ggtgtaggtgaagcgtcttaccaactaagttgagcttcattgtcaatttttaatattaattaagaaaataaacttattaggctgaatatttattggccaa |
42968647 |
T |
 |
| Q |
137 |
agtataacnnnnnnnnnncaaaatggcnnnnnnntatttgaaatgatctaaattgggtattacctttacttttgccacatggaattgggatttggaggga |
236 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42968646 |
agtataacttttttttt-caaaatggcaaaaaaatatttgaaatgatctaaattgggtattacctttacttttgccacatggaattgggatttggaggga |
42968548 |
T |
 |
| Q |
237 |
actttatacaagaaccaagaaatggtaaaaataaatcatacacaagatgctcaatatgactgactgttat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42968547 |
actttatacaagaaccaagaaatggtaaaaataaatcatacacaagatgctcaatatgactgattgttat |
42968478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 43 - 82
Target Start/End: Original strand, 36815804 - 36815843
Alignment:
| Q |
43 |
ggtgaagcgtcttaccaactaagttgagcttcattgtcaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36815804 |
ggtgaagcgtcttaccaactaagttgcacttcattgtcaa |
36815843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 65
Target Start/End: Complemental strand, 12260630 - 12260602
Alignment:
| Q |
37 |
ggtgtaggtgaagcgtcttaccaactaag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12260630 |
ggtgtaggtgaagcgtcttaccaactaag |
12260602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University