View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_high_23 (Length: 302)
Name: NF5684_high_23
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 262
Target Start/End: Original strand, 30842413 - 30842655
Alignment:
| Q |
20 |
atgatttcattctcaaagcttctaattgcatttcgagttctaataagtcccgtgatgctgcttcttcttcttcttccaagaattttgtttcttcttcgaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842413 |
atgatttcattctcaaagcttctaattgcatttcgagttctaataagtcccgtgatgctgcttcttcttcttcttccaagaattttgtttcttcttcgag |
30842512 |
T |
 |
| Q |
120 |
tttattcgataaagaaggtgtcgagattaaggagaagaagggttcaaagttagcattatttaccaaggatgacagttatttggtgaataataaggctatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842513 |
tttattcgataaagaaggtgtcgagattaaggagaagaagggttcaaagttagcattatttactaaggatgacagttatttggtgaataataaggctatg |
30842612 |
T |
 |
| Q |
220 |
tctacattcaagtttaatactgatgcttatgcaattggacaca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842613 |
tctacattcaagtttaatactgatgcttatgcaattggacaca |
30842655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University