View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_high_25 (Length: 280)
Name: NF5684_high_25
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 36 - 262
Target Start/End: Complemental strand, 1600025 - 1599798
Alignment:
| Q |
36 |
caactttacaagacattggatgagatggtgaggtgatgctagtcatattcctgcagtctcagaatggaagcctgatttcttcttctgctggagggtgtga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600025 |
caactttacaagacattggatgagatggtgaggtgaggctagtcatattcctgcagtctcagaatggaagcctgatttcttcttctgctggagggtgtga |
1599926 |
T |
 |
| Q |
136 |
tttggttctcttaaattttctgaagcctttttcgtttcgttactt-aaataacgttttcaatagtaaaatagtagtagtctttgttgaagtaaggtgttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1599925 |
tttggttctcttaaattttctgaagcctttttcgtttctttacttaaaataacgttttcaatagtaaaatagtagtagtctttgttgaagtaaggtgttt |
1599826 |
T |
 |
| Q |
235 |
tgttatgtgaaagttgttaacttgttat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1599825 |
tgttatgtgaaagttgttaacttgttat |
1599798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 1600076 - 1600035
Alignment:
| Q |
1 |
ttgcattactaaataatcagttgaagattgaaatgcaacttt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600076 |
ttgcattactaaataatcagttgaagattgaaatgcaacttt |
1600035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 80 - 141
Target Start/End: Original strand, 5769010 - 5769071
Alignment:
| Q |
80 |
atattcctgcagtctcagaatggaagcctgatttcttcttctgctggagggtgtgatttggt |
141 |
Q |
| |
|
||||| ||| ||||| ||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5769010 |
atatttctggagtctaggaatggatacctgatttcttcttctgctggaaggtgtgatttggt |
5769071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University