View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_high_27 (Length: 273)
Name: NF5684_high_27
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 18245639 - 18245905
Alignment:
| Q |
1 |
caaatggccccgccggatattcttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245639 |
caaatggccccgccggatattcttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacat |
18245738 |
T |
 |
| Q |
101 |
tatcaaagcagctgtgacccctgcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245739 |
tatcaaagcagctgtgacccctgcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagtt |
18245838 |
T |
 |
| Q |
201 |
attccacttcacactcaccccggtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245839 |
attccacttcacactcaccccggtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
18245905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 18252743 - 18253009
Alignment:
| Q |
1 |
caaatggccccgccggatattcttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacat |
100 |
Q |
| |
|
|||||||||| || ||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
18252743 |
caaatggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacat |
18252842 |
T |
 |
| Q |
101 |
tatcaaagcagctgtgacccctgcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagtt |
200 |
Q |
| |
|
||||||||| ||||| ||| ||||| | ||||| |||||| | ||| |||||||||||||||||||| |||| ||||||||| |||||| ||||| ||| |
|
|
| T |
18252843 |
tatcaaagccgctgttaccactgcaatagacgcacaatttcccggtgtaaacggtcttggaatttccattgctcgtttagatatagccgttggtggtgtt |
18252942 |
T |
 |
| Q |
201 |
attccacttcacactcaccccggtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
267 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
18252943 |
attccacttcacacacaccccggtgcttcggaagtgttggttgttattaaaggaacaatcagtgctg |
18253009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 18256825 - 18256559
Alignment:
| Q |
1 |
caaatggccccgccggatattcttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacat |
100 |
Q |
| |
|
|||||||||| || ||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
18256825 |
caaatggcccggctggatattcttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacat |
18256726 |
T |
 |
| Q |
101 |
tatcaaagcagctgtgacccctgcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagtt |
200 |
Q |
| |
|
||||||||| ||||| ||| ||||| | ||||| |||||| | ||| |||||||||||||||| ||| |||| ||||||||| |||||| |||||| ||| |
|
|
| T |
18256725 |
tatcaaagccgctgttaccactgcaatagacgcacaatttcccggtgtaaacggtcttggaatatccattgcacgtttagatatagccgtaggtggtgtt |
18256626 |
T |
 |
| Q |
201 |
attccacttcacactcaccccggtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
267 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
18256625 |
attccacttcacacacaccccggtgcttcggaagtgttggttgttattaaaggaacaatcagtgctg |
18256559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University