View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_high_28 (Length: 272)
Name: NF5684_high_28
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 256
Target Start/End: Complemental strand, 53819222 - 53818983
Alignment:
| Q |
17 |
atgaatcgtggatgacaactaattacagtttcatttgccggtacctgatctgctaatccattaaggatattgggaaggtttagcatgttaggcctaacat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53819222 |
atgaatcgtggatgacaactaattacagtttcatttgccggtacctgatctgctaatccattaaggatagtgggaaggtttagcatgttaggcctaacat |
53819123 |
T |
|
| Q |
117 |
tacaactaactcataaataattagtgcacatgatttcttaagctaatacgaatataattggaccaatggtttgttaagcatatgtgattatttttatata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53819122 |
tacaactaactcataaataattagtgcacatgatttcttaagctaatacgaatataattggaccaatggtttgttaagcatatgtgattatttttatata |
53819023 |
T |
|
| Q |
217 |
ataatctataccaaacaatgtgattttataagcaggttga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53819022 |
ataatctataccaaacaatgtgattttataagcaggttga |
53818983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University