View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_high_32 (Length: 256)
Name: NF5684_high_32
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 81 - 235
Target Start/End: Complemental strand, 38770254 - 38770100
Alignment:
| Q |
81 |
tcttaatcttcttttgtctagtattttcatatctgctacactgaaatgatttaatcatttcataaactcggtactacaatgacattaataaacacatata |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770254 |
tcttaatcttcttttgtctagtattttcatatctgctacactgaaatgatttaatcatttcataaactcggtactacaatgacattaataaacacatata |
38770155 |
T |
 |
| Q |
181 |
gatataagctgaaaataggattatgtatttgaagacgaggatgaagagtgaataa |
235 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38770154 |
gatataagcggaaaataggattatgtatttgaagacgagggtgaagagtgaataa |
38770100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 38770398 - 38770355
Alignment:
| Q |
1 |
tgtgtatataaatatatgctatcaattgcatgactgagtgtcat |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38770398 |
tgtgtatataaatatatgctatcaattgcatgactgagtgtcat |
38770355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University