View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_low_20 (Length: 338)
Name: NF5684_low_20
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 57 - 332
Target Start/End: Original strand, 7579913 - 7580186
Alignment:
| Q |
57 |
atcgaatttatgatattcattggatgcaaatattgatgctaaaccctagaaatgtgaaacgtatatacnnnnnnnnnntcacatacctacccaaaaaaca |
156 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | || ||||||||||||||||||| |
|
|
| T |
7579913 |
atcgacttcatgatattcattggatgcaaatattgatgctaaaccctagaaatgtgaaac--atacaaaaaaaaaaaatcgcatacctacccaaaaaaca |
7580010 |
T |
|
| Q |
157 |
ggacaaaaatcacatagagaatgataacaacaaactgattgaacaacttgtctaggtttatcggaagtgcctgcaaattgtacgtttcaaagccaacaaa |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7580011 |
ggacaaaaatcacatagagaatgataacaacaaactgattgaacaacttgtctaggtttatcggaagtacctgcaaattgtacgtttcaaagccaacaaa |
7580110 |
T |
|
| Q |
257 |
tattacaagttagacatgatttaggaatcaaacacaacacaaccaatgattcaacataaaacatacaatataccca |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7580111 |
tattacaagttagacatgatttaggaatcaaacacaacacaaccaatgattcaacataaaacatacaatataccca |
7580186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University