View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5684_low_35 (Length: 257)

Name: NF5684_low_35
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5684_low_35
NF5684_low_35
[»] chr5 (1 HSPs)
chr5 (158-239)||(33432559-33432640)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 158 - 239
Target Start/End: Original strand, 33432559 - 33432640
Alignment:
158 ttattctctgtgttttgaacttataattacagtaaagtacaatattaaaacaaccaaagaacaatatttatatatggctact 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33432559 ttattctctgtgttttgaacttataattacagtaaagtacaatattaaaacaaccaaagaacaatatttatatatggctact 33432640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University