View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_low_41 (Length: 245)
Name: NF5684_low_41
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 5636889 - 5637105
Alignment:
| Q |
18 |
cctagtagggaatttatctaattagaacttcttcattttctagtagtagttggtcgttgtaagatataatcctttatagtatttctttgtttaaaatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5636889 |
cctagtagggaatttatctaattagaacttctgcattttctagtagtagttggtctttgtaagatataatcctttatagtatttttttgtttaaaatcaa |
5636988 |
T |
 |
| Q |
118 |
gctttgaaaaatatcctagatgtttatagtgtagcactagtatacttgaatatttggaaaattagtgnnnnnnnnntgttcaaattgtcatggctgaaag |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5636989 |
gctttgaaaaatatcctacatgtttatagagtagcactagtatacttgaatatttggaaaattagtgaaaaaaaaatgttcaaattgtcatggctgaaag |
5637088 |
T |
 |
| Q |
218 |
tgcagatgttgtatatt |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5637089 |
tgcagatgttgtatatt |
5637105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University