View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_low_44 (Length: 242)
Name: NF5684_low_44
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 40 - 225
Target Start/End: Complemental strand, 28278924 - 28278739
Alignment:
| Q |
40 |
cattaaatagtctataatatttgacatttaatagttaatttataatctgttttataggcaaatttatgatattgttgattagattctctttataatatca |
139 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28278924 |
cattaaataatctataatatttgacatttaatagttaatttataatctgttttataggcaaatttatgatattgttaattagattctctttataatatca |
28278825 |
T |
|
| Q |
140 |
tcttagggtgaaagatttctgttttgtcaaacatgggcgataactgagacggtgaaaccttaccaaatgccactcatagccaatct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28278824 |
tcttagggtgaaagatttctgttttgtcaaacatgggcgataactgagacggtgaaaccttaccaaatgccactcatagccaatct |
28278739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University