View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5684_low_48 (Length: 222)
Name: NF5684_low_48
Description: NF5684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5684_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 40415645 - 40415457
Alignment:
| Q |
19 |
agaaacagctctatttggaggcagcgtgcctccaaaattgatgactccatactcactatggtacgtggggcaacagtttatatccaagtagcactgacat |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
40415645 |
agaaacagccctatttggaggcagcgtgcctccaaaattgatgactccatactcactaaggtacgtggggcaacagtttatacccaagtaacactgacat |
40415546 |
T |
 |
| Q |
119 |
ttcaggttaaatttgttgtcaatgtctaacaccgagacgactatgacacacatgttacgatcaatcacattcatttccctaagtatatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40415545 |
ttcaggttaaatttgttgtcaatgtctaacaccgagacgactgtgacacacatgttacgatcaatcacattcatttccctaagtatatt |
40415457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University