View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5685-Insertion-3 (Length: 220)
Name: NF5685-Insertion-3
Description: NF5685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5685-Insertion-3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-109
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 21446312 - 21446100
Alignment:
| Q |
8 |
gaggttagtttgaacttttttgcaaatttttgtgttcaacattaaactgggtatgctgtgcwtgattgttaaggttaggaatgctagcataattgggatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21446312 |
gaggttagtttgaacttttttgcaaatttttgtgttcaacattaaactgggtatgctgcgcatgattgttaaggttaggaatgctagcataattgggatg |
21446213 |
T |
 |
| Q |
108 |
ccttgctctatcttgatgcatctccatatctatcctcttttcttgttattttaaattttcttatttatttagctcaaggaagaattctcgattaacgtgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21446212 |
ccttgctctatcttgatgcatctccatatctatcctcttttcttgttattttaaattttcttatttatttagctcaaggaagaattctcgattaatatgt |
21446113 |
T |
 |
| Q |
208 |
cttttgttcttgt |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21446112 |
cttttgttcttgt |
21446100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University