View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5685-Insertion-4 (Length: 114)
Name: NF5685-Insertion-4
Description: NF5685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5685-Insertion-4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 7348939 - 7348833
Alignment:
| Q |
8 |
aggatgatgttggtgttttggatagtactgttggtcgtgctaagttgtctcctcttcatttagcagctgccaatggtcggatcgaggtagctattcttcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7348939 |
aggatgatgttggtgttttggatagtactgttggtcgtgctaagttgtctcctcttcatttagcagctgccaatggtcggatcgaggtagttattcttcc |
7348840 |
T |
|
| Q |
108 |
tcgacac |
114 |
Q |
| |
|
||||||| |
|
|
| T |
7348839 |
tcgacac |
7348833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University