View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5685_high_2 (Length: 479)
Name: NF5685_high_2
Description: NF5685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5685_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 337; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 13 - 478
Target Start/End: Original strand, 7791804 - 7792274
Alignment:
| Q |
13 |
tcatcacgacaagcaattgcggaataggggattcggggtctcgaagggtttgttgattcaattagctgatatgatttaggtcttgagctgtagagaagaa |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7791804 |
tcatgacgacaagcaattgcggaataggggattcggggtctcgaagggtttgttggttcaattagctgatatgatttaggtcttgagctgtagagaagaa |
7791903 |
T |
 |
| Q |
113 |
gaacaatttatgggtttggggatttggatcttgaaaggtttggtctaaaggtggatagaataagaaaaattagcttatgcaatttggatctggacaggat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| | |
|
|
| T |
7791904 |
gaacaatttatgggtttggggatttggatcttgaatggtttggtctaaaggtggatagaataagaaaagttagcttatgcaatttggatctggaaaggct |
7792003 |
T |
 |
| Q |
213 |
caactatggtgggaggggagagaagaggaaagggggaaactgtgagtgaaagaaagaaaatgaatctgaggtgtcagannnnnnnnnnnnagccaaagct |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
7792004 |
caactatgatgggaggggagagaagaggaaaggggtaaactgtgagtgaaagaaagaaaatgaatctgaggtgtccgattttttatttttagccaaagct |
7792103 |
T |
 |
| Q |
313 |
gttttaatagcgttttctggca-gcaggtgtact----tgcatgtaagggatgtcactttggaatctgcttcaccatttccgaggggcattcccacgcaa |
407 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7792104 |
g-tttaatagcgttttctggcaggcaggtgtacttgcatgcatgtaagggatgccacttcggaatctgcttcaccatttccgaggggcattcccacgcaa |
7792202 |
T |
 |
| Q |
408 |
aacacctggcaaatgctgacaaaacactgcttttgc--agacaaaaacacaagcgtatttaaattttgtttcc |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||| |
|
|
| T |
7792203 |
aacacctggcaaatgctgacaaaacactgcttttgcagagacaaaaacac-agtgtatttaaattttgtttcc |
7792274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 478
Target Start/End: Original strand, 7777422 - 7777482
Alignment:
| Q |
418 |
aaatgctgacaaaacactgcttttgc--agacaaaaacacaagcgtatttaaattttgtttcc |
478 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| || ||| ||||||||||||||| |
|
|
| T |
7777422 |
aaatgctgacaaaacactgcttttgcatagacaaaaacac-agtgta-ttaaattttgtttcc |
7777482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University