View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5685_high_4 (Length: 278)
Name: NF5685_high_4
Description: NF5685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5685_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 262
Target Start/End: Original strand, 34085974 - 34086218
Alignment:
| Q |
11 |
cagagatccagaatcctttgtcttctattggtcgatatccgacaggaaattcaannnnnnngtttatttgtggtgggtgttgtcagtggtaaatagtagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34085974 |
cagagatccagaatcctttgtcttctattggtcgatatccgacaggaaattcaatttttttgtttatttgt----ggtgttgtcagtggtaaatagtagg |
34086069 |
T |
 |
| Q |
111 |
tttgtttcaatcttttagggattttgtggattcatcgcagatatcgtcgaagggagggtataattttacttgcaatctctattttactcctttggtttga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34086070 |
tttgtttcaatcttttagggattttgtggattcatcgcagttatcgtcgaagggagggtataattttacttgcaatctctattttacccctttggtttga |
34086169 |
T |
 |
| Q |
211 |
ggactagataagaaggatgtgtttgtgattcgagtggagcaggtttcaattt |
262 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34086170 |
ggactagat---aaggatgtgtttgtgattcgagtggagcaggtttcaattt |
34086218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 102 - 257
Target Start/End: Original strand, 39076944 - 39077096
Alignment:
| Q |
102 |
aatagtaggtttgtttcaatcttttagggattttgtggattcatcgcagatatcgtcgaagggagggtataattttacttgcaatctctattttactcct |
201 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| |||||||||||||||| || || | || || || |||||||||| ||||||||| ||| ||| |
|
|
| T |
39076944 |
aatagtaggtttgtttcaaacttttaaagatttggtggattcatcgcagaaattttctagggtagtgtgtaattttactcaatatctctattctacccct |
39077043 |
T |
 |
| Q |
202 |
ttggtttgaggactagataagaaggatgtgtttgtgattcgagtggagcaggtttc |
257 |
Q |
| |
|
|| ||||||||||| || |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
39077044 |
ctgttttgaggactatat---aaggatgtgtttgtgatttgagcggagcaggtttc |
39077096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 263
Target Start/End: Complemental strand, 42387079 - 42387039
Alignment:
| Q |
223 |
aaggatgtgtttgtgattcgagtggagcaggtttcaatttt |
263 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||||| |
|
|
| T |
42387079 |
aaggatgtgtttgtggttcgattggagcaggtatcaatttt |
42387039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University