View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5686-Insertion-1 (Length: 56)
Name: NF5686-Insertion-1
Description: NF5686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5686-Insertion-1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 7e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 7e-20
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 6063429 - 6063381
Alignment:
| Q |
8 |
tctgattcatagttttttctctgatcaggtgagtcattcagatcccaca |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6063429 |
tctgattcatagttttttctctgatcaggtgagtcattcagatcccaca |
6063381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University