View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5686_low_4 (Length: 315)
Name: NF5686_low_4
Description: NF5686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5686_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 5 - 256
Target Start/End: Original strand, 9872344 - 9872585
Alignment:
| Q |
5 |
tgtccaagaatattttagaactgatatatcaattttaaaaacaaacaaaaatctttattgagaacaactacatttatataccttggttttttatgctgca |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9872344 |
tgtccatgaatattttagaactgatatattaattttaaaaacaaacaaaaatctttattgagaacca---------tataccttggttttttatgctgca |
9872434 |
T |
 |
| Q |
105 |
agttcgggggctccactagccactttagattaaaaacattcacttataaacatatacattaatttatactaattatttatgtatttgtcacattattatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9872435 |
agttcgggggctccactagccactttagattaaatacattcacttataaacatatacattaatttatactaattatttatgtatttgtcacattattatt |
9872534 |
T |
 |
| Q |
205 |
aagnnnnnnnncacaagagagcaaataaaaacgctcttttgtgctgggaaaa |
256 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
9872535 |
aag-aaaaaaacataagagagcaaataaaaacgctcttttgtgttggaaaaa |
9872585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University