View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5688_low_1 (Length: 679)
Name: NF5688_low_1
Description: NF5688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5688_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 537; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 537; E-Value: 0
Query Start/End: Original strand, 111 - 663
Target Start/End: Complemental strand, 40542161 - 40541609
Alignment:
| Q |
111 |
tttgattaattctaaatcctcaaaaaggttgacgtgaagctgagttgttgttgtttcccgcccaaccatcaacaggtaactgatgaacattctgcatatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40542161 |
tttgattaattctaaatcctcaaaaaggttgacgtgaagctgagttgttgttgtttcccgcccaaccatcaacaggtagctgatgaacattctgcatatt |
40542062 |
T |
|
| Q |
211 |
caatggcaaattgaaaaacggtaaaccagaagatggatcaggaaatggattgttattattattgccgccaccgccaccaccggagccttgagaacctcct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40542061 |
caatggcaaattgaaaaacggtaaaccagaagatggatcaggaaatggattgttattattattgccgccaccgccaccaccggagccttgagaacctcct |
40541962 |
T |
|
| Q |
311 |
ccagcctcagcctgcatctgaagctgctcctcttccaacggcaacttctcataagcaacattagtaaaagaagctgcaatcacaatcaccggcccggccg |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40541961 |
ccagcctcagcctgcatctgaagctgctcctcttccaacggcaatttctcataagcaacattagtaaaagaagctgcaatcacaatcaccggcccggccg |
40541862 |
T |
|
| Q |
411 |
cgataagctcaccaaccacgctacctcccaccacctgtccttgtcctccagcaagataaatcgttaagctagttgctccgggaggagctggtggtggcgg |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40541861 |
cgataagctcaccaaccacgctacctcccaccacctgtccttgtcctccagcaagataaatcgttaagctagttgctccgggaggagctggtggtggcag |
40541762 |
T |
|
| Q |
511 |
aaaagatccagacaaggataatatctcaaatcttccatgtagcgtaacaacaccaccagccgccgctggttgccggatactgacatttgtcacagtgcca |
610 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40541761 |
aaaagatccagacaaggataatatctcaaatcttccatgtagcgtaacaacaccaccagccgccgctggttgccggatactgacatttgtcacagtgcca |
40541662 |
T |
|
| Q |
611 |
ctgccgctgagaacacagatcccacgttgacgacggcgagcataggtagatac |
663 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40541661 |
ctgccgctgagaacacagatcccacgttgacggcggcgagcataggtagatac |
40541609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University