View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5688_low_9 (Length: 203)
Name: NF5688_low_9
Description: NF5688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5688_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 72 - 190
Target Start/End: Complemental strand, 7387904 - 7387786
Alignment:
| Q |
72 |
ctttagggaatggatatgtggttttagctacacatggccacaaattggatctgcctctaacaacagtcattgtatcatatttaagtggacaaaatgatcc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7387904 |
ctttagggaatggatatgtggttttagccacacatggccacaaattggatctgcctctgacaacagtcattgtatcatatttaagtggacaaaatgatcc |
7387805 |
T |
|
| Q |
172 |
ttctgttgtatgatatatt |
190 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
7387804 |
ttctgttgtaggatatatt |
7387786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University