View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_high_57 (Length: 250)
Name: NF5689_high_57
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_high_57 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 7085565 - 7085328
Alignment:
| Q |
13 |
aatattgtaaggagcaatggttttgcttgcgtgtgagagatcgaaagtgaggacaaaatgtgagatagtgtttgagtttggtgtagtgcgcatgcatttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7085565 |
aatattgtaaggagcaatggttttgcttgcgtgtgagagatcgaaagtgaggacaaaatgtgagatagtgtttgagtttggtgtagtgcgcatgcatttc |
7085466 |
T |
 |
| Q |
113 |
aaagagtggctgccagccacaagcataagatttactagtatccatgacgcattactttcacatcatttttacctcttgaaactacaaaattttatttcat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
7085465 |
aaagagtggctgccagccacaagcataagatttactagtatccatgacgcattactttcacatcatttttacctcttaaaactgcaaaattttatttcat |
7085366 |
T |
 |
| Q |
213 |
tctgaactcacaaattttcatcattgccttcaaattta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7085365 |
tctgaactcacaaattttcatcattgccttcaaattta |
7085328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 243
Target Start/End: Original strand, 49016759 - 49016795
Alignment:
| Q |
207 |
tttcattctgaactcacaaattttcatcattgccttc |
243 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49016759 |
tttcattctgaactcacaatttttcatcattgccttc |
49016795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University