View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_high_73 (Length: 233)
Name: NF5689_high_73
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_high_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 4631547 - 4631764
Alignment:
| Q |
1 |
atcaatggtgtatatatat-tattaaatttttcaaaaggtcttgcatctattaatcttacattacatannnnnnnaatctttcaaacagatggcaatacg |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
4631547 |
atcaatggtgtatatatatgtattaaatttttcaaaaggtcttgcatctattaatcttag-ttacatatttttttaatctttcaaacagatggcaatacg |
4631645 |
T |
|
| Q |
100 |
ttgtgtgatatgatttcaattattcaactagcatagtatacctgatttgcacattttcggcgtgtgattatcagtgtttttaataaacaagcgttagttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
4631646 |
ttgtgtgatatgatttcaattattcaactagcatagtatacctgatttgcacattttcgacgtgtgattatcagtgtttttattaaacaaccgttagttt |
4631745 |
T |
|
| Q |
200 |
taattttataacttataaa |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4631746 |
taattttataacttataaa |
4631764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 208
Target Start/End: Original strand, 4635785 - 4635894
Alignment:
| Q |
99 |
gttgtgtgatatgatttcaattattcaactagcatagtatacctgatttgcacattttcggcgtgtgattatcagtgtttttaataaacaagcgttagtt |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| || ||||| |||||||||||| |||||||| || ||| |||||||| ||||||| |||||||| |
|
|
| T |
4635785 |
gttgtgtgttatgatttcaattattcaactaggatcttatacgtgatttgcacatattcggcgtttgtttacatgtgtttttggtaaacaaacgttagtt |
4635884 |
T |
|
| Q |
199 |
ttaattttat |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
4635885 |
ttaattttat |
4635894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University