View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_29 (Length: 362)
Name: NF5689_low_29
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 31069311 - 31069397
Alignment:
| Q |
1 |
aattgcttcagttcttccaaaaatggtcaaggaatatcacaagattcatctcaacacatttcgttaatataaataagaagataatag |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069311 |
aattgcttcagttcttccaaaaatggtcaaggaatatcacaagattcatctcaacacatttcgttaatataaataagaagataatag |
31069397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 150 - 219
Target Start/End: Original strand, 31069460 - 31069529
Alignment:
| Q |
150 |
atgtcttcttccttcagcaaggtgatgttaagcttcaaaaccattccccctattcttcacttgtgtctct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31069460 |
atgtcttcttccttcagcaaggtgatgttaagcttcaaaaccattccccctattcttcacttgtgtctct |
31069529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 286 - 351
Target Start/End: Original strand, 31069596 - 31069661
Alignment:
| Q |
286 |
atgaagttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31069596 |
atgaagttgttcttctgctacttgaaagattttgcgggaagagaaatgacggtagaactcaagaat |
31069661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 286 - 350
Target Start/End: Original strand, 37614334 - 37614398
Alignment:
| Q |
286 |
atgaagttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaa |
350 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
37614334 |
atgaagctgttcttctcgtacttcaaagatttggtgggaagagaagtgacggttgaactcaagaa |
37614398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 290 - 350
Target Start/End: Original strand, 42440446 - 42440506
Alignment:
| Q |
290 |
agttgttcttctgctacttgaaagattttgtgggaagagaaatgacggtagaactcaagaa |
350 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
42440446 |
agttgttcttctcatacttcaaagatttggtgggaagagaagttacggtagaactcaagaa |
42440506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University