View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_34 (Length: 332)
Name: NF5689_low_34
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 31068934 - 31069137
Alignment:
| Q |
16 |
acttctccagtcaaactctattacaaaaatgttgatgtggaaaatttgatgttgaagcgccgcttcagccagcaaattgtatttcttcttaattataaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31068934 |
acttctccagtcaaactctattacaaaaatgttgatgtggaaaatttgatgttgaagcgccgcttcagccagcaaattgtatttcttcttaattataaaa |
31069033 |
T |
 |
| Q |
116 |
aattatcttcttcatttgttcattaatcttcttcatcatcaccatttacccaaatctcaccccttttcattaaaaatccttttcaacccatttgttataa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31069034 |
aattatcttcttcatttgttcattaatcttcttcatcatcaccatttacccaaatctcaccccttttcattaaaaacccttttcaacccatttgttataa |
31069133 |
T |
 |
| Q |
216 |
tttc |
219 |
Q |
| |
|
|||| |
|
|
| T |
31069134 |
tttc |
31069137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University