View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_42 (Length: 313)
Name: NF5689_low_42
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 39 - 297
Target Start/End: Original strand, 30346079 - 30346328
Alignment:
| Q |
39 |
ttagtaagcattactattagaggaaatcagcacttgtactgcaccatgtgcagataaattttctacttattagatcaacaagtcacgtcatatcacattt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346079 |
ttagtaagcattactattagaggaaatcagcacttgtactgcaccatgcgcagataaattttctacttattagatcaacaagtcacgtcatatcacattt |
30346178 |
T |
 |
| Q |
139 |
gatctaatgatattatagtaagatttatctgcgcatggttgaaacaagctcaaacaagctcgtgtatgatgtaaatcttgtctcacttgtgtaccataaa |
238 |
Q |
| |
|
||||||||||||||||||||||| |||| || || || | | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346179 |
gatctaatgatattatagtaagacttat-------tgattcaa--tggttgaaacaagctcgtgtatgatgtaaatcttgtctcacttgtgtaccataaa |
30346269 |
T |
 |
| Q |
239 |
attgatgttaaattagtctcttaaattagagaactttggttattaatttagtctttttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346270 |
attgatgttaaattagtctcttaaattagagaactttggttattaatttagtctttttt |
30346328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University