View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5689_low_45 (Length: 308)
Name: NF5689_low_45
Description: NF5689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5689_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 147 - 296
Target Start/End: Complemental strand, 11262980 - 11262831
Alignment:
| Q |
147 |
catgcattgcagaaatattaaagataggtgttcaaataacctcaacgaaagattgtgggttagtacaattgcaacatctctatgttccattctttgcagt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11262980 |
catgcattgcagaaatattaaagataggtgttcaaataaactcaatgaaagattgtgggttagtataattgcaacatctctatgttccattctttgcagt |
11262881 |
T |
|
| Q |
247 |
catttctcaataaagcttaaagatcaaaatttgtactatgcatatatatt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11262880 |
catttctcaataaagcttaaagatcaaaatttgtactatgcatatatatt |
11262831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 11263093 - 11262974
Alignment:
| Q |
1 |
ccacatataacgttccgaacctcaggtagtactatcattttccataagaccttccaattagcttctactctcaatgttgcactttctacaagctcattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11263093 |
ccacatataacgttccgaacctcaggtagtactatcattttccataagaccttccaattagcttctactctcaatgttgcactttctacaagctcattca |
11262994 |
T |
|
| Q |
101 |
agcagatact-accatgcat |
119 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
11262993 |
agcagatactcaccatgcat |
11262974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University